Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1944364..1944460 | Replicon | chromosome |
Accession | NZ_CP023964 | ||
Organism | Yersinia frederiksenii strain FDAARGOS_418 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1944364..1944456 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1944364..1944460 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
CRN75_RS22930 | 1939500..1939652 | - | 153 | WP_004709453.1 | hypothetical protein | - |
CRN75_RS08690 | 1939934..1940890 | + | 957 | WP_004709451.1 | prolyl aminopeptidase | - |
CRN75_RS08695 | 1940944..1941174 | - | 231 | WP_004709448.1 | DNA polymerase III subunit theta | - |
CRN75_RS08700 | 1941570..1942079 | + | 510 | WP_004709447.1 | non-heme ferritin | - |
CRN75_RS08705 | 1942474..1942860 | + | 387 | WP_004709445.1 | CopC domain-containing protein YobA | - |
CRN75_RS08710 | 1942862..1943746 | + | 885 | WP_004709444.1 | copper homeostasis membrane protein CopD | - |
CRN75_RS08715 | 1943843..1944184 | + | 342 | WP_004709441.1 | YebY family protein | - |
CRN75_RS08720 | 1944535..1945617 | - | 1083 | WP_032913217.1 | phage integrase Arm DNA-binding domain-containing protein | - |
CRN75_RS08725 | 1945592..1945858 | - | 267 | WP_032912248.1 | excisionase | - |
CRN75_RS08730 | 1945931..1946443 | - | 513 | WP_032912247.1 | siphovirus Gp157 family protein | - |
CRN75_RS08735 | 1946440..1948587 | - | 2148 | WP_032912246.1 | hypothetical protein | - |
CRN75_RS08740 | 1948601..1948873 | - | 273 | WP_004712689.1 | hypothetical protein | - |
CRN75_RS08745 | 1949125..1949457 | - | 333 | WP_004712687.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1938760..2012195 | 73435 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 93 bp
>T86521 NZ_CP023964:1944364-1944456 [Yersinia frederiksenii]
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
TAAGCCTACGTTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCCTTTCCCTAGACCGAATATAGGAATCGTAT
TCGGTCTTTTTTT
Antitoxin
Download Length: 97 bp
>AT86521 NZ_CP023964:c1944460-1944364 [Yersinia frederiksenii]
AGTTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAACGTAGGCTTA
AGTTAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAAGGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTG
GCATTAACGTAGGCTTA