Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2192779..2192924 | Replicon | chromosome |
| Accession | NZ_CP121189 | ||
| Organism | Salmonella enterica subsp. enterica serovar Indiana strain S1467 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2192819..2192922 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2192779..2192924 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P6164_RS10640 | 2189205..2189903 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| P6164_RS10645 | 2189927..2190583 | - | 657 | WP_023227121.1 | carbon-nitrogen hydrolase family protein | - |
| P6164_RS10650 | 2190691..2190921 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P6164_RS10655 | 2191059..2191433 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P6164_RS10660 | 2191434..2192309 | + | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
| P6164_RS10665 | 2192326..2192679 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2192779..2192924 | - | 146 | - | - | Antitoxin |
| - | 2192819..2192922 | + | 104 | - | - | Toxin |
| P6164_RS10670 | 2193043..2193693 | - | 651 | Protein_2088 | tyrosine-type recombinase/integrase | - |
| P6164_RS10675 | 2193963..2194169 | + | 207 | Protein_2089 | phage tail protein | - |
| P6164_RS10680 | 2194254..2194496 | + | 243 | Protein_2090 | DUF4376 domain-containing protein | - |
| P6164_RS10685 | 2194602..2194933 | + | 332 | Protein_2091 | DUF1353 domain-containing protein | - |
| P6164_RS10690 | 2194982..2195091 | + | 110 | Protein_2092 | tail fiber assembly protein | - |
| P6164_RS10695 | 2195182..2195367 | - | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| P6164_RS10700 | 2195619..2195807 | - | 189 | Protein_2094 | tail fiber assembly protein | - |
| P6164_RS10705 | 2195803..2196573 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| P6164_RS10710 | 2197063..2197191 | + | 129 | Protein_2096 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2187119..2195033 | 7914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T276017 NZ_CP121189:2192819-2192922 [Salmonella enterica subsp. enterica serovar Indiana]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT276017 NZ_CP121189:c2192924-2192779 [Salmonella enterica subsp. enterica serovar Indiana]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
