Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2642850..2642993 | Replicon | chromosome |
| Accession | NZ_CP121076 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain R22.3740 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2642852..2642955 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2642850..2642993 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| P8I06_RS12890 | 2637980..2638180 | + | 201 | Protein_2526 | PagK family vesicle-borne virulence factor | - |
| P8I06_RS12895 | 2638277..2638788 | - | 512 | Protein_2527 | tail fiber assembly protein | - |
| P8I06_RS12900 | 2638801..2639088 | - | 288 | Protein_2528 | macro domain-containing protein | - |
| P8I06_RS12905 | 2639098..2639313 | - | 216 | Protein_2529 | shikimate transporter | - |
| P8I06_RS12910 | 2639315..2639575 | - | 261 | Protein_2530 | DUF1441 family protein | - |
| P8I06_RS12915 | 2639883..2640050 | + | 168 | WP_000789529.1 | lytic enzyme | - |
| P8I06_RS12920 | 2640307..2640840 | - | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| P8I06_RS12925 | 2640894..2641085 | - | 192 | Protein_2533 | glycoside hydrolase family 19 protein | - |
| P8I06_RS12930 | 2641074..2641535 | + | 462 | Protein_2534 | DNA breaking-rejoining protein | - |
| P8I06_RS12935 | 2641799..2642692 | + | 894 | Protein_2535 | tyrosine-type recombinase/integrase | - |
| - | 2642850..2642993 | + | 144 | - | - | Antitoxin |
| - | 2642852..2642955 | - | 104 | - | - | Toxin |
| P8I06_RS12940 | 2643095..2643448 | - | 354 | WP_000722368.1 | YebY family protein | - |
| P8I06_RS12945 | 2643465..2644340 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| P8I06_RS12950 | 2644341..2644715 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| P8I06_RS12955 | 2644853..2645083 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| P8I06_RS12960 | 2645191..2645847 | + | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| P8I06_RS12965 | 2645871..2646569 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2623270..2648655 | 25385 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T275639 NZ_CP121076:c2642955-2642852 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT275639 NZ_CP121076:2642850-2642993 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
