Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1955756..1955899 | Replicon | chromosome |
| Accession | NZ_CP117693 | ||
| Organism | Salmonella enterica subsp. enterica serovar London strain S1 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1955795..1955897 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1955756..1955899 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PTQ18_RS09310 | 1952180..1952878 | - | 699 | WP_023255939.1 | exodeoxyribonuclease X | - |
| PTQ18_RS09315 | 1952902..1953558 | - | 657 | WP_023245437.1 | carbon-nitrogen hydrolase family protein | - |
| PTQ18_RS09320 | 1953666..1953896 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PTQ18_RS09325 | 1954034..1954408 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| PTQ18_RS09330 | 1954409..1955284 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| PTQ18_RS09335 | 1955301..1955654 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1955756..1955899 | - | 144 | - | - | Antitoxin |
| - | 1955795..1955897 | + | 103 | - | - | Toxin |
| PTQ18_RS09340 | 1956037..1957116 | - | 1080 | WP_058107134.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| PTQ18_RS09345 | 1957149..1958300 | - | 1152 | Protein_1825 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| PTQ18_RS09350 | 1958289..1958480 | + | 192 | Protein_1826 | glycoside hydrolase family 19 protein | - |
| PTQ18_RS09355 | 1958534..1959067 | + | 534 | WP_023256014.1 | DUF2514 domain-containing protein | - |
| PTQ18_RS09360 | 1959324..1959491 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PTQ18_RS09365 | 1959556..1959744 | - | 189 | WP_001034748.1 | hypothetical protein | - |
| PTQ18_RS09370 | 1959799..1960059 | + | 261 | Protein_1830 | DUF1441 family protein | - |
| PTQ18_RS09375 | 1960061..1960276 | + | 216 | Protein_1831 | shikimate transporter | - |
| PTQ18_RS09380 | 1960286..1960573 | + | 288 | Protein_1832 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1932569..1976068 | 43499 | |
| - | inside | Prophage | - | sopE2 | 1932569..1974062 | 41493 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T272027 NZ_CP117693:1955795-1955897 [Salmonella enterica subsp. enterica serovar London]
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT272027 NZ_CP117693:c1955899-1955756 [Salmonella enterica subsp. enterica serovar London]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCTCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
