Detailed information of TA system TA271975

Bioinformatically predicted

Overview

TA module

• Type: I
• Classification (family/domain): hok-sok/-
• Location: 44102..44523
• Replicon: plasmid pEA11_1
• Accession: NZ_CP117669
• Organism: Escherichia albertii strain BIA_11

Toxin (Protein)

• Gene name: hok
• Uniprot ID: -
• Locus tag: PS054_RS23810
• Protein ID: WP_089521964.1
• Coordinates: 44398..44523 (+)
• Length: 42 a.a.

Antitoxin (RNA)

Gene name	srnC
Locus tag	-
Coordinates	44102..44300 (+)

Genomic Context

Locus tag	Coordinates	Strand	Size (bp)	Protein ID	Product	Description
PS054_RS23770 (40087)	40087..40815	-	729	WP_273815702.1	molecular chaperone	-
PS054_RS23775 (40869)	40869..41417	-	549	WP_059222180.1	fimbrial protein	-
PS054_RS23780 (42494)	42494..42708	-	215	Protein_39	S24 family peptidase	-
PS054_RS23785 (42689)	42689..43042	+	354	Protein_40	hypothetical protein	-
PS054_RS23790 (43128)	43128..43277	+	150	Protein_41	conjugation system SOS inhibitor PsiB family protein	-
PS054_RS23795 (43311)	43311..43842	+	532	Protein_42	plasmid SOS inhibition protein A	-
PS054_RS23800 (43839)	43839..44153	+	315	WP_273815704.1	theronine dehydrogenase	-
- (44102)	44102..44300	+	199	NuclAT_0	-	Antitoxin
- (44102)	44102..44300	+	199	NuclAT_0	-	Antitoxin
- (44102)	44102..44300	+	199	NuclAT_0	-	Antitoxin
- (44102)	44102..44300	+	199	NuclAT_0	-	Antitoxin
PS054_RS23805 (44307)	44307..44456	+	150	Protein_44	plasmid maintenance protein Mok	-
PS054_RS23810 (44398)	44398..44523	+	126	WP_089521964.1	type I toxin-antitoxin system Hok family toxin	Toxin
PS054_RS23815 (44815)	44815..45036	+	222	Protein_46	hypothetical protein	-
PS054_RS23820 (45141)	45141..45962	+	822	WP_273815709.1	DUF932 domain-containing protein	-
PS054_RS23825 (46259)	46259..46792	-	534	WP_273815711.1	transglycosylase SLT domain-containing protein	-
PS054_RS23830 (47186)	47186..47569	+	384	WP_273815714.1	conjugal transfer relaxosome DNA-binding protein TraM	-
PS054_RS23835 (47764)	47764..48450	+	687	WP_273815716.1	PAS domain-containing protein	-
PS054_RS23840 (48540)	48540..48767	+	228	WP_001254386.1	conjugal transfer relaxosome protein TraY	-
PS054_RS23845 (48801)	48801..49160	+	360	WP_273815718.1	type IV conjugative transfer system pilin TraA	-
PS054_RS23850 (49175)	49175..49486	+	312	WP_000012106.1	type IV conjugative transfer system protein TraL	-

Associated MGEs

MGE detail	Similar MGEs	Relative position	MGE Type	Cargo ARG	Virulence gene	Coordinates	Length (bp)
	-	inside	Conjugative plasmid	-	vat	1..110945	110945

Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.

Domains

Predicted by InterproScan

Toxin

• Hok/gef cell toxic protein (2-37)

Sequences

Toxin

Protein

• Length: 42 a.a.
• Molecular weight: 4788.69 Da
• Isoelectric Point: 8.4890

>T271975 WP_089521964.1 NZ_CP117669:44398-44523 [Escherichia albertii]
VLIVCLTLLIFTYLTRKSLCEIRYRDGYREVAAFLAYESGK

Nucleotide

• Length: 126 bp

Antitoxin

Nucleotide

• Length: 199 bp

>AT271975 NZ_CP117669:44102-44300 [Escherichia albertii]
ACTGATTGCCTGTGAACCGGCTGAACGACCGGATTATTTTCAGGGAAAGTGAGAGTGGTCAGCGTGCAGACATATGGGCT
ATGATGTGCCCGGCGCTTGAGGCTTTCTGCCTCATGACGTGAATGAAGGTGGTTTGTTACCGTGTTGTGTGGCAGAAGGA
CAAAAGCCCCGTAGTTAATTTTTCATTAACCCACGAGGC

Structures

Antitoxin