Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2045456..2045601 | Replicon | chromosome |
| Accession | NZ_CP117376 | ||
| Organism | Salmonella enterica subsp. enterica serovar Newport strain RM041 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2045496..2045599 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2045456..2045601 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PQQ16_RS09885 | 2041882..2042580 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| PQQ16_RS09890 | 2042604..2043260 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| PQQ16_RS09895 | 2043368..2043598 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| PQQ16_RS09900 | 2043736..2044110 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
| PQQ16_RS09905 | 2044111..2044986 | + | 876 | WP_000979684.1 | copper homeostasis membrane protein CopD | - |
| PQQ16_RS09910 | 2045003..2045356 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2045456..2045601 | - | 146 | - | - | Antitoxin |
| - | 2045496..2045599 | + | 104 | - | - | Toxin |
| PQQ16_RS09915 | 2045729..2046808 | - | 1080 | WP_000087646.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| PQQ16_RS09920 | 2046838..2047833 | - | 996 | Protein_1937 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| PQQ16_RS09925 | 2047981..2048229 | + | 249 | Protein_1938 | glycoside hydrolase family 19 protein | - |
| PQQ16_RS09930 | 2048226..2048760 | + | 535 | Protein_1939 | DUF2514 domain-containing protein | - |
| PQQ16_RS09935 | 2049017..2049184 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| PQQ16_RS09940 | 2049249..2049437 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| PQQ16_RS09945 | 2049492..2049752 | + | 261 | Protein_1942 | DUF1441 family protein | - |
| PQQ16_RS09950 | 2049967..2050311 | + | 345 | Protein_1943 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2025456..2085357 | 59901 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270928 NZ_CP117376:2045496-2045599 [Salmonella enterica subsp. enterica serovar Newport]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270928 NZ_CP117376:c2045601-2045456 [Salmonella enterica subsp. enterica serovar Newport]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
