Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2725852..2725997 | Replicon | chromosome |
Accession | NZ_CP117351 | ||
Organism | Salmonella enterica subsp. enterica serovar Dublin strain RM100 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2725854..2725957 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2725852..2725997 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQQ10_RS13500 | 2722732..2723562 | + | 831 | WP_024139186.1 | recombination protein RecT | - |
PQQ10_RS13505 | 2723609..2723794 | + | 186 | WP_000280163.1 | DUF1187 family protein | - |
PQQ10_RS13510 | 2723893..2724321 | + | 429 | WP_000743301.1 | hypothetical protein | - |
PQQ10_RS13515 | 2724382..2724660 | + | 279 | WP_001675651.1 | excisionase | - |
PQQ10_RS13520 | 2724635..2725714 | + | 1080 | WP_076031669.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2725852..2725997 | + | 146 | - | - | Antitoxin |
- | 2725854..2725957 | - | 104 | - | - | Toxin |
PQQ10_RS13525 | 2726097..2726450 | - | 354 | WP_000722368.1 | YebY family protein | - |
PQQ10_RS13530 | 2726467..2727342 | - | 876 | WP_000979703.1 | copper homeostasis membrane protein CopD | - |
PQQ10_RS13535 | 2727343..2727717 | - | 375 | WP_001751617.1 | CopC domain-containing protein YobA | - |
PQQ10_RS13540 | 2727855..2728085 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PQQ10_RS13545 | 2728193..2728849 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
PQQ10_RS13550 | 2728873..2729571 | + | 699 | WP_000944287.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2644969..2747867 | 102898 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270722 NZ_CP117351:c2725957-2725854 [Salmonella enterica subsp. enterica serovar Dublin]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT270722 NZ_CP117351:2725852-2725997 [Salmonella enterica subsp. enterica serovar Dublin]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG