Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2681438..2681581 | Replicon | chromosome |
Accession | NZ_CP117322 | ||
Organism | Salmonella enterica subsp. enterica serovar Derby strain RM001 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2681440..2681543 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2681438..2681581 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
PQP82_RS12975 | 2676885..2677154 | + | 270 | WP_077248370.1 | hypothetical protein | - |
PQP82_RS12980 | 2677320..2677460 | + | 141 | WP_048348799.1 | hypothetical protein | - |
PQP82_RS12985 | 2677606..2678133 | - | 528 | Protein_2542 | transposase | - |
PQP82_RS12990 | 2678153..2678245 | - | 93 | WP_230855586.1 | hypothetical protein | - |
PQP82_RS12995 | 2678275..2680695 | - | 2421 | WP_048348800.1 | type III secretion system effector SspH3 | - |
PQP82_RS13000 | 2680868..2680951 | - | 84 | Protein_2545 | phage tail protein | - |
PQP82_RS13005 | 2681040..2681309 | + | 270 | WP_017441955.1 | tyrosine-type recombinase/integrase | - |
- | 2681438..2681581 | + | 144 | - | - | Antitoxin |
- | 2681440..2681543 | - | 104 | - | - | Toxin |
PQP82_RS13010 | 2681683..2682036 | - | 354 | WP_023232537.1 | YebY family protein | - |
PQP82_RS13015 | 2682053..2682928 | - | 876 | WP_072103686.1 | copper homeostasis membrane protein CopD | - |
PQP82_RS13020 | 2682929..2683303 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
PQP82_RS13025 | 2683441..2683671 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
PQP82_RS13030 | 2683779..2684435 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
PQP82_RS13035 | 2684459..2685157 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T270494 NZ_CP117322:c2681543-2681440 [Salmonella enterica subsp. enterica serovar Derby]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT270494 NZ_CP117322:2681438-2681581 [Salmonella enterica subsp. enterica serovar Derby]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG