Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | txpA-ratA/- |
| Location | 2464748..2464972 | Replicon | chromosome |
| Accession | NZ_CP116557 | ||
| Organism | Enterococcus faecalis strain K194-1 | ||
Toxin (Protein)
| Gene name | txpA | Uniprot ID | - |
| Locus tag | PML86_RS11570 | Protein ID | WP_162780856.1 |
| Coordinates | 2464871..2464972 (-) | Length | 34 a.a. |
Antitoxin (RNA)
| Gene name | ratA | ||
| Locus tag | - | ||
| Coordinates | 2464748..2464934 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PML86_RS11545 (2460366) | 2460366..2461319 | - | 954 | WP_002375576.1 | siderophore ABC transporter substrate-binding protein | - |
| PML86_RS11550 (2461358) | 2461358..2462113 | - | 756 | WP_002375575.1 | ATP-binding cassette domain-containing protein | - |
| PML86_RS11555 (2462110) | 2462110..2463075 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML86_RS11560 (2463072) | 2463072..2464019 | - | 948 | WP_002375573.1 | iron chelate uptake ABC transporter family permease subunit | - |
| PML86_RS11565 (2464203) | 2464203..2464655 | + | 453 | WP_002375572.1 | YueI family protein | - |
| - (2464711) | 2464711..2464917 | + | 207 | NuclAT_7 | - | - |
| - (2464748) | 2464748..2464934 | + | 187 | NuclAT_9 | - | Antitoxin |
| PML86_RS11570 (2464871) | 2464871..2464972 | - | 102 | WP_162780856.1 | putative holin-like toxin | Toxin |
| PML86_RS11575 (2465164) | 2465164..2467434 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
| PML86_RS11580 (2467605) | 2467605..2468105 | + | 501 | WP_002395960.1 | cysteine hydrolase family protein | - |
| PML86_RS11585 (2468904) | 2468904..2469800 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3624.40 Da Isoelectric Point: 6.0656
>T268883 WP_162780856.1 NZ_CP116557:c2464972-2464871 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNNKK
MSIEATLELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 187 bp
>AT268883 NZ_CP116557:2464748-2464934 [Enterococcus faecalis]
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAGCGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAACGCAACAAGGGTTGCA
AAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAGCGCCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTT
TTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGGTTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCG
AAAATCAGTAACGCAACAAGGGTTGCA
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|