Detailed information of TA system
Overview
TA module
| Type | I | Classification (family/domain) | hok-sok/- |
| Location | 67835..68050 | Replicon | plasmid pDETEC2 |
| Accession | NZ_CP116168 | ||
| Organism | Escherichia coli strain DETEC-P169 | ||
Toxin (Protein)
| Gene name | hok | Uniprot ID | - |
| Locus tag | PID12_RS24210 | Protein ID | WP_271292905.1 |
| Coordinates | 67835..67942 (-) | Length | 36 a.a. |
Antitoxin (RNA)
| Gene name | sok | ||
| Locus tag | - | ||
| Coordinates | 68019..68050 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| PID12_RS24180 (63323) | 63323..63832 | - | 510 | WP_000628100.1 | conjugal transfer entry exclusion protein TraS | - |
| PID12_RS24185 (63829) | 63829..65418 | - | 1590 | Protein_72 | conjugal transfer protein TraG | - |
| PID12_RS24190 (65483) | 65483..66211 | - | 729 | WP_001230787.1 | type-F conjugative transfer system secretin TraK | - |
| PID12_RS24195 (66198) | 66198..66764 | - | 567 | WP_000399792.1 | type IV conjugative transfer system protein TraE | - |
| PID12_RS24200 (66786) | 66786..67085 | - | 300 | WP_241220505.1 | type IV conjugative transfer system protein TraL | - |
| PID12_RS24205 (67127) | 67127..67824 | + | 698 | WP_103215986.1 | IS1-like element IS1A family transposase | - |
| PID12_RS24210 (67835) | 67835..67942 | - | 108 | WP_271292905.1 | type I toxin-antitoxin system Hok family toxin | Toxin |
| PID12_RS24215 (67899) | 67899..68033 | - | 135 | Protein_78 | plasmid maintenance protein Mok | - |
| - (68019) | 68019..68050 | - | 32 | NuclAT_1 | - | Antitoxin |
| - (68019) | 68019..68050 | - | 32 | NuclAT_1 | - | Antitoxin |
| - (68019) | 68019..68050 | - | 32 | NuclAT_1 | - | Antitoxin |
| - (68019) | 68019..68050 | - | 32 | NuclAT_1 | - | Antitoxin |
| - (69492) | 69492..69689 | - | 198 | NuclAT_0 | - | - |
| - (69492) | 69492..69689 | - | 198 | NuclAT_0 | - | - |
| - (69492) | 69492..69689 | - | 198 | NuclAT_0 | - | - |
| - (69492) | 69492..69689 | - | 198 | NuclAT_0 | - | - |
| PID12_RS24225 (69501) | 69501..69689 | + | 189 | WP_001299721.1 | hypothetical protein | - |
| PID12_RS24230 (69658) | 69658..70420 | - | 763 | Protein_81 | plasmid SOS inhibition protein A | - |
| PID12_RS24235 (70417) | 70417..70851 | - | 435 | WP_000845937.1 | conjugation system SOS inhibitor PsiB | - |
| PID12_RS24240 (70906) | 70906..71103 | - | 198 | Protein_83 | hypothetical protein | - |
| PID12_RS24245 (71131) | 71131..71364 | - | 234 | WP_000005990.1 | DUF905 family protein | - |
| PID12_RS24250 (71432) | 71432..71929 | - | 498 | WP_042039995.1 | single-stranded DNA-binding protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Non-Mobilizable plasmid | mph(A) / aac(3)-IIa / blaCTX-M-15 / blaOXA-1 / aac(6')-Ib-cr / tet(A) / sitABCD | iutA / iucD / iucC / iucB / iucA | 1..113066 | 113066 | |
| - | inside | IScluster/Tn | - | - | 67321..69444 | 2123 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 36 a.a. Molecular weight: 4170.01 Da Isoelectric Point: 9.2862
>T268253 WP_271292905.1 NZ_CP116168:c67942-67835 [Escherichia coli]
VLIVCLTLLIFTYLTRKSLCEIRYRDGHREVAAFR
VLIVCLTLLIFTYLTRKSLCEIRYRDGHREVAAFR
Download Length: 108 bp
Antitoxin
Download Length: 32 bp
>AT268253 NZ_CP116168:c68050-68019 [Escherichia coli]
CACCACGAGGCATCCCTATGTCTAGTCCACAT
CACCACGAGGCATCCCTATGTCTAGTCCACAT
Similar Proteins
Only experimentally validated proteins are listed.
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
| Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
|---|
