Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1956645..1956788 | Replicon | chromosome |
| Accession | NZ_CP110934 | ||
| Organism | Salmonella enterica strain CVCC 519 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1956683..1956786 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1956645..1956788 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| ORG43_RS09440 | 1953069..1953767 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| ORG43_RS09445 | 1953791..1954447 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| ORG43_RS09450 | 1954555..1954785 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| ORG43_RS09455 | 1954923..1955297 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| ORG43_RS09460 | 1955298..1956173 | + | 876 | WP_001540235.1 | copper homeostasis membrane protein CopD | - |
| ORG43_RS09465 | 1956190..1956543 | + | 354 | WP_038394002.1 | YebY family protein | - |
| - | 1956645..1956788 | - | 144 | - | - | Antitoxin |
| - | 1956683..1956786 | + | 104 | - | - | Toxin |
| ORG43_RS09470 | 1956917..1957567 | - | 651 | Protein_1849 | tyrosine-type recombinase/integrase | - |
| ORG43_RS09475 | 1957590..1957883 | + | 294 | WP_001540231.1 | hypothetical protein | - |
| ORG43_RS09480 | 1957837..1958043 | + | 207 | Protein_1851 | phage tail protein | - |
| ORG43_RS09485 | 1958215..1958370 | + | 156 | Protein_1852 | phage tail protein | - |
| ORG43_RS09490 | 1958476..1958808 | + | 333 | WP_031606598.1 | DUF1353 domain-containing protein | - |
| ORG43_RS09495 | 1958857..1958966 | + | 110 | Protein_1854 | tail fiber assembly protein | - |
| ORG43_RS09500 | 1959486..1959581 | - | 96 | WP_024133706.1 | hypothetical protein | - |
| ORG43_RS09505 | 1959679..1960448 | - | 770 | Protein_1856 | transporter substrate-binding domain-containing protein | - |
| ORG43_RS09510 | 1960524..1960616 | + | 93 | Protein_1857 | DUF4113 domain-containing protein | - |
| ORG43_RS09515 | 1960939..1961067 | + | 129 | Protein_1858 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1950983..1994599 | 43616 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T264514 NZ_CP110934:1956683-1956786 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT264514 NZ_CP110934:c1956788-1956645 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
