Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2814068..2814213 | Replicon | chromosome |
| Accession | NZ_CP110873 | ||
| Organism | Enterobacter kobei strain SCLZS19 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2814075..2814178 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2814068..2814213 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| OQE50_RS13710 | 2809225..2809443 | + | 219 | WP_006176198.1 | hypothetical protein | - |
| OQE50_RS13715 | 2809440..2809736 | + | 297 | WP_042889503.1 | DUF4406 domain-containing protein | - |
| OQE50_RS13720 | 2809733..2809924 | + | 192 | WP_266071098.1 | DUF1382 family protein | - |
| OQE50_RS13725 | 2810016..2810525 | + | 510 | WP_252067359.1 | HNH endonuclease | - |
| OQE50_RS13730 | 2810528..2810743 | + | 216 | WP_266071102.1 | TraR/DksA family transcriptional regulator | - |
| OQE50_RS13735 | 2810743..2811198 | + | 456 | WP_139964092.1 | hypothetical protein | - |
| OQE50_RS13740 | 2811221..2811760 | + | 540 | WP_266071106.1 | HNH endonuclease | - |
| OQE50_RS13745 | 2811870..2812511 | + | 642 | WP_163358434.1 | hypothetical protein | - |
| OQE50_RS13750 | 2812671..2812943 | + | 273 | WP_103142239.1 | excisionase | - |
| OQE50_RS13755 | 2812912..2813997 | + | 1086 | WP_103142238.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| - | 2814068..2814213 | + | 146 | - | - | Antitoxin |
| - | 2814075..2814178 | - | 104 | - | - | Toxin |
| OQE50_RS13760 | 2814317..2814655 | - | 339 | WP_071922110.1 | YebY family protein | - |
| OQE50_RS13765 | 2814672..2815541 | - | 870 | WP_023330712.1 | copper homeostasis membrane protein CopD | - |
| OQE50_RS13770 | 2815543..2815914 | - | 372 | WP_014884301.1 | CopC domain-containing protein YobA | - |
| OQE50_RS13775 | 2816052..2816282 | + | 231 | WP_013096102.1 | DNA polymerase III subunit theta | - |
| OQE50_RS13780 | 2816393..2817043 | + | 651 | WP_193970475.1 | carbon-nitrogen hydrolase family protein | - |
| OQE50_RS13785 | 2817068..2817730 | + | 663 | WP_014884303.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2754970..2835763 | 80793 | |
| - | inside | Prophage | - | - | 2747420..2835763 | 88343 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T264417 NZ_CP110873:c2814178-2814075 [Enterobacter kobei]
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT264417 NZ_CP110873:2814068-2814213 [Enterobacter kobei]
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
AATAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCCTTTTAAGAATAGATGACGACGCCAGGTTTTCCAGT
