Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1999504..1999649 | Replicon | chromosome |
| Accession | NZ_CP104677 | ||
| Organism | Salmonella enterica strain PNUSAS036471 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1999544..1999647 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1999504..1999649 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| N4534_RS09675 | 1995930..1996628 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| N4534_RS09680 | 1996652..1997308 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| N4534_RS09685 | 1997416..1997646 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| N4534_RS09690 | 1997784..1998158 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
| N4534_RS09695 | 1998159..1999034 | + | 876 | WP_000979686.1 | copper homeostasis membrane protein CopD | - |
| N4534_RS09700 | 1999051..1999404 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1999504..1999649 | - | 146 | - | - | Antitoxin |
| - | 1999544..1999647 | + | 104 | - | - | Toxin |
| N4534_RS09705 | 1999777..2000856 | - | 1080 | WP_000087646.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| N4534_RS09710 | 2000886..2001881 | - | 996 | Protein_1895 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| N4534_RS09715 | 2002029..2002277 | + | 249 | Protein_1896 | glycoside hydrolase family 19 protein | - |
| N4534_RS09720 | 2002274..2002808 | + | 535 | Protein_1897 | DUF2514 domain-containing protein | - |
| N4534_RS09725 | 2003065..2003232 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| N4534_RS09730 | 2003297..2003485 | - | 189 | WP_001521334.1 | hypothetical protein | - |
| N4534_RS09735 | 2003540..2003800 | + | 261 | Protein_1900 | DUF1441 family protein | - |
| N4534_RS09740 | 2004015..2004359 | + | 345 | Protein_1901 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1993842..2026414 | 32572 | |
| - | inside | Prophage | - | sopE2 | 1993842..2039339 | 45497 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T258949 NZ_CP104677:1999544-1999647 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT258949 NZ_CP104677:c1999649-1999504 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG