Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1949531..1949676 | Replicon | chromosome |
Accession | NZ_CP100678 | ||
Organism | Salmonella enterica subsp. enterica serovar Anatum strain R17.0809 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1949571..1949674 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1949531..1949676 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
NL708_RS09285 | 1945957..1946655 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
NL708_RS09290 | 1946679..1947335 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
NL708_RS09295 | 1947443..1947673 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
NL708_RS09300 | 1947811..1948185 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
NL708_RS09305 | 1948186..1949061 | + | 876 | WP_072101102.1 | copper homeostasis membrane protein CopD | - |
NL708_RS09310 | 1949078..1949431 | + | 354 | WP_000722368.1 | YebY family protein | - |
- | 1949531..1949676 | - | 146 | - | - | Antitoxin |
- | 1949571..1949674 | + | 104 | - | - | Toxin |
NL708_RS09315 | 1949803..1950882 | - | 1080 | WP_020438172.1 | phage integrase Arm DNA-binding domain-containing protein | - |
NL708_RS09320 | 1950915..1952066 | - | 1152 | Protein_1818 | PD-(D/E)XK nuclease-like domain-containing protein | - |
NL708_RS09325 | 1952055..1952246 | + | 192 | Protein_1819 | glycoside hydrolase family 19 protein | - |
NL708_RS09330 | 1952300..1952833 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
NL708_RS09335 | 1953090..1953257 | - | 168 | WP_000789530.1 | lytic enzyme | - |
NL708_RS09340 | 1953322..1953510 | - | 189 | WP_001521334.1 | hypothetical protein | - |
NL708_RS09345 | 1953565..1954056 | + | 492 | WP_000348541.1 | DUF1441 family protein | - |
NL708_RS09350 | 1954043..1954610 | + | 568 | Protein_1824 | phage terminase large subunit family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 | 1943871..1984610 | 40739 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T250971 NZ_CP100678:1949571-1949674 [Salmonella enterica subsp. enterica serovar Anatum]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT250971 NZ_CP100678:c1949676-1949531 [Salmonella enterica subsp. enterica serovar Anatum]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG