Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2162964..2163109 | Replicon | chromosome |
| Accession | NZ_CP098829 | ||
| Organism | Salmonella enterica subsp. enterica serovar Indiana strain YZ20MCS6 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2163004..2163107 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2162964..2163109 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| NFG92_RS10530 | 2159390..2160088 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| NFG92_RS10535 | 2160112..2160753 | - | 642 | WP_229026485.1 | carbon-nitrogen hydrolase family protein | - |
| NFG92_RS10540 | 2160876..2161106 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| NFG92_RS10545 | 2161244..2161618 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| NFG92_RS10550 | 2161619..2162494 | + | 876 | WP_001579467.1 | copper homeostasis membrane protein CopD | - |
| NFG92_RS10555 | 2162511..2162864 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2162964..2163109 | - | 146 | - | - | Antitoxin |
| - | 2163004..2163107 | + | 104 | - | - | Toxin |
| NFG92_RS10560 | 2163228..2163878 | - | 651 | Protein_2068 | tyrosine-type recombinase/integrase | - |
| NFG92_RS10565 | 2164148..2164354 | + | 207 | Protein_2069 | phage tail protein | - |
| NFG92_RS10570 | 2164439..2164681 | + | 243 | Protein_2070 | DUF4376 domain-containing protein | - |
| NFG92_RS10575 | 2164787..2165118 | + | 332 | Protein_2071 | DUF1353 domain-containing protein | - |
| NFG92_RS10580 | 2165167..2165276 | + | 110 | Protein_2072 | tail fiber assembly protein | - |
| NFG92_RS10585 | 2165367..2165552 | - | 186 | WP_071787785.1 | PagK family vesicle-borne virulence factor | - |
| NFG92_RS10590 | 2165804..2165992 | - | 189 | Protein_2074 | tail fiber assembly protein | - |
| NFG92_RS10595 | 2165988..2166758 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| NFG92_RS10605 | 2167248..2167376 | + | 129 | Protein_2076 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2157304..2165218 | 7914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T248119 NZ_CP098829:2163004-2163107 [Salmonella enterica subsp. enterica serovar Indiana]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT248119 NZ_CP098829:c2163109-2162964 [Salmonella enterica subsp. enterica serovar Indiana]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
