Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | I | Classification (family/domain) | txpA-ratA/- |
Location | 2505041..2505302 | Replicon | chromosome |
Accession | NZ_CP097042 | ||
Organism | Enterococcus faecalis strain AT34 |
Toxin (Protein)
Gene name | txpA | Uniprot ID | - |
Locus tag | M2910_RS11845 | Protein ID | WP_162780856.1 |
Coordinates | 2505201..2505302 (-) | Length | 34 a.a. |
Antitoxin (RNA)
Gene name | ratA | ||
Locus tag | - | ||
Coordinates | 2505041..2505247 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
M2910_RS11820 (2500696) | 2500696..2501649 | - | 954 | WP_002375576.1 | siderophore ABC transporter substrate-binding protein | - |
M2910_RS11825 (2501688) | 2501688..2502443 | - | 756 | WP_002375575.1 | ATP-binding cassette domain-containing protein | - |
M2910_RS11830 (2502440) | 2502440..2503405 | - | 966 | WP_002371665.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2910_RS11835 (2503402) | 2503402..2504349 | - | 948 | WP_002375573.1 | iron chelate uptake ABC transporter family permease subunit | - |
M2910_RS11840 (2504533) | 2504533..2504985 | + | 453 | WP_002375572.1 | YueI family protein | - |
- (2505041) | 2505041..2505247 | + | 207 | NuclAT_7 | - | Antitoxin |
- (2505078) | 2505078..2505264 | + | 187 | NuclAT_9 | - | - |
M2910_RS11845 (2505201) | 2505201..2505302 | - | 102 | WP_162780856.1 | putative holin-like toxin | Toxin |
M2910_RS11850 (2505494) | 2505494..2507764 | - | 2271 | WP_002368430.1 | bifunctional glutamate--cysteine ligase/glutathione synthetase | - |
M2910_RS11855 (2507935) | 2507935..2508435 | + | 501 | WP_002395960.1 | cysteine hydrolase family protein | - |
M2910_RS11860 (2509234) | 2509234..2510130 | + | 897 | WP_002368434.1 | YitT family protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 34 a.a. Molecular weight: 3624.40 Da Isoelectric Point: 6.0656
>T244542 WP_162780856.1 NZ_CP097042:c2505302-2505201 [Enterococcus faecalis]
MSIEATLELMISFATLVALLIFGILEATKNNKK
MSIEATLELMISFATLVALLIFGILEATKNNKK
Download Length: 102 bp
Antitoxin
Download Length: 207 bp
>AT244542 NZ_CP097042:2505041-2505247 [Enterococcus faecalis]
TTCCATTTATAATAGAATTGTGCTATTATGAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGG
TTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
TTCCATTTATAATAGAATTGTGCTATTATGAAGATGAAAAAGAGAGGTATGCGGGTACATACCTCTCCTTTATACCAGCG
CCAGTTATAAGAACTGGTGGCTTACTGAGTTAAGTTTTTTATTACTGTTTAACCGTTCGGCCTGTCAAGCTTATGAACGG
TTATTTTTTATTGTTTTTCGTTGCTTCAAGGATACCGAAAATCAGTA
Similar Proteins
Only experimentally validated proteins are listed.
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|
Protein | Organism | Identities (%) | Coverage (%) | Ha-value |
---|