Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2642951..2643094 | Replicon | chromosome |
| Accession | NZ_CP093400 | ||
| Organism | Salmonella enterica subsp. enterica serovar Infantis strain R21.1147 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2642953..2643056 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2642951..2643094 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| MOP59_RS12865 | 2638081..2638281 | + | 201 | Protein_2526 | PagK family vesicle-borne virulence factor | - |
| MOP59_RS12870 | 2638378..2638889 | - | 512 | Protein_2527 | tail fiber assembly protein | - |
| MOP59_RS12875 | 2638902..2639189 | - | 288 | Protein_2528 | macro domain-containing protein | - |
| MOP59_RS12880 | 2639199..2639414 | - | 216 | Protein_2529 | shikimate transporter | - |
| MOP59_RS12885 | 2639416..2639676 | - | 261 | Protein_2530 | DUF1441 family protein | - |
| MOP59_RS12890 | 2639984..2640151 | + | 168 | WP_000789529.1 | lytic enzyme | - |
| MOP59_RS12895 | 2640408..2640941 | - | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| MOP59_RS12900 | 2640995..2641186 | - | 192 | Protein_2533 | glycoside hydrolase family 19 protein | - |
| MOP59_RS12905 | 2641175..2641636 | + | 462 | Protein_2534 | DNA breaking-rejoining protein | - |
| MOP59_RS12910 | 2641900..2642793 | + | 894 | Protein_2535 | tyrosine-type recombinase/integrase | - |
| - | 2642951..2643094 | + | 144 | - | - | Antitoxin |
| - | 2642953..2643056 | - | 104 | - | - | Toxin |
| MOP59_RS12915 | 2643196..2643549 | - | 354 | WP_000722368.1 | YebY family protein | - |
| MOP59_RS12920 | 2643566..2644441 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| MOP59_RS12925 | 2644442..2644816 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| MOP59_RS12930 | 2644954..2645184 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| MOP59_RS12935 | 2645292..2645948 | + | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| MOP59_RS12940 | 2645972..2646670 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2620762..2648756 | 27994 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T238450 NZ_CP093400:c2643056-2642953 [Salmonella enterica subsp. enterica serovar Infantis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT238450 NZ_CP093400:2642951-2643094 [Salmonella enterica subsp. enterica serovar Infantis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
