Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2101517..2101659 | Replicon | chromosome |
Accession | NZ_CP092184 | ||
Organism | Serratia marcescens strain YHYF1 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2101561..2101657 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2101517..2101659 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
MF265_RS10165 (MF265_10165) | 2096784..2097179 | + | 396 | WP_048322942.1 | RidA family protein | - |
MF265_RS10170 (MF265_10170) | 2097336..2098289 | + | 954 | WP_004928848.1 | prolyl aminopeptidase | - |
MF265_RS10175 (MF265_10175) | 2098322..2098552 | - | 231 | WP_016928156.1 | DNA polymerase III subunit theta | - |
MF265_RS10180 (MF265_10180) | 2098897..2099415 | + | 519 | WP_015377481.1 | non-heme ferritin | - |
MF265_RS10185 (MF265_10185) | 2099708..2100124 | + | 417 | WP_046686875.1 | CopC domain-containing protein YobA | - |
MF265_RS10190 (MF265_10190) | 2100127..2101008 | + | 882 | WP_239044467.1 | copper homeostasis membrane protein CopD | - |
MF265_RS10195 (MF265_10195) | 2101078..2101419 | + | 342 | WP_049300694.1 | YebY family protein | - |
- | 2101517..2101659 | - | 143 | - | - | Antitoxin |
- | 2101561..2101657 | + | 97 | - | - | Toxin |
MF265_RS10200 (MF265_10200) | 2101744..2102823 | - | 1080 | WP_239044468.1 | phage integrase Arm DNA-binding domain-containing protein | - |
MF265_RS10205 (MF265_10205) | 2102759..2103067 | - | 309 | WP_239044469.1 | excisionase | - |
MF265_RS10210 (MF265_10210) | 2103130..2104482 | - | 1353 | WP_239044470.1 | class I SAM-dependent methyltransferase | - |
MF265_RS10215 (MF265_10215) | 2104561..2104872 | - | 312 | WP_239044471.1 | hypothetical protein | - |
MF265_RS10220 (MF265_10220) | 2105092..2105289 | - | 198 | WP_239044472.1 | hypothetical protein | - |
MF265_RS10225 (MF265_10225) | 2105406..2105936 | + | 531 | WP_239044473.1 | hypothetical protein | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 2091429..2118478 | 27049 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 97 bp
>T235768 NZ_CP092184:2101561-2101657 [Serratia marcescens]
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
AACAAGCCCTGCATTAAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTAGACCGAATATAGGAATC
GTATTCGGTCTTTTTTT
Antitoxin
Download Length: 143 bp
>AT235768 NZ_CP092184:c2101659-2101517 [Serratia marcescens]
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG
ATAAAAAAAGACCGAATACGATTCCTATATTCGGTCTAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTTAATGCAGGGCTTGTTCAGCCGTGCACTTTAAGAGTAGCCTACCGCGCCAGTTTTGCCAG