Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1967159..1967302 | Replicon | chromosome |
| Accession | NZ_CP091636 | ||
| Organism | Salmonella enterica strain 1063 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1967197..1967300 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1967159..1967302 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L5504_RS09320 | 1963583..1964281 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| L5504_RS09325 | 1964305..1964961 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| L5504_RS09330 | 1965069..1965299 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L5504_RS09335 | 1965437..1965811 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| L5504_RS09340 | 1965812..1966687 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| L5504_RS09345 | 1966704..1967057 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 1967159..1967302 | - | 144 | - | - | Antitoxin |
| - | 1967197..1967300 | + | 104 | - | - | Toxin |
| L5504_RS09350 | 1967431..1968081 | - | 651 | Protein_1825 | tyrosine-type recombinase/integrase | - |
| L5504_RS09355 | 1968092..1968397 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| L5504_RS09360 | 1968354..1968557 | + | 204 | Protein_1827 | phage tail protein | - |
| L5504_RS09365 | 1968729..1968884 | + | 156 | Protein_1828 | phage tail protein | - |
| L5504_RS09370 | 1968990..1969322 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| L5504_RS09375 | 1969371..1969480 | + | 110 | Protein_1830 | tail fiber assembly protein | - |
| L5504_RS09380 | 1969571..1969756 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| L5504_RS09385 | 1970008..1970196 | - | 189 | Protein_1832 | tail fiber assembly protein | - |
| L5504_RS09390 | 1970192..1970962 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| L5504_RS09395 | 1971032..1971130 | + | 99 | Protein_1834 | DUF4113 domain-containing protein | - |
| L5504_RS09400 | 1971453..1971581 | + | 129 | Protein_1835 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1961495..1974538 | 13043 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T234157 NZ_CP091636:1967197-1967300 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT234157 NZ_CP091636:c1967302-1967159 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
