Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1980990..1981133 | Replicon | chromosome |
| Accession | NZ_CP091622 | ||
| Organism | Salmonella enterica strain 1419 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1981028..1981131 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1980990..1981133 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L5509_RS09420 | 1977414..1978112 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| L5509_RS09425 | 1978136..1978792 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| L5509_RS09430 | 1978900..1979130 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L5509_RS09435 | 1979268..1979642 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| L5509_RS09440 | 1979643..1980518 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| L5509_RS09445 | 1980535..1980888 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 1980990..1981133 | - | 144 | - | - | Antitoxin |
| - | 1981028..1981131 | + | 104 | - | - | Toxin |
| L5509_RS09450 | 1981262..1981912 | - | 651 | Protein_1845 | tyrosine-type recombinase/integrase | - |
| L5509_RS09455 | 1981923..1982228 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| L5509_RS09460 | 1982185..1982388 | + | 204 | Protein_1847 | phage tail protein | - |
| L5509_RS09465 | 1982560..1982715 | + | 156 | Protein_1848 | phage tail protein | - |
| L5509_RS09470 | 1982821..1983153 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| L5509_RS09475 | 1983202..1983311 | + | 110 | Protein_1850 | tail fiber assembly protein | - |
| L5509_RS09480 | 1983402..1983587 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| L5509_RS09485 | 1983839..1984027 | - | 189 | Protein_1852 | tail fiber assembly protein | - |
| L5509_RS09490 | 1984023..1984793 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| L5509_RS09495 | 1984863..1984961 | + | 99 | Protein_1854 | DUF4113 domain-containing protein | - |
| L5509_RS09500 | 1985284..1985412 | + | 129 | Protein_1855 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 1975326..1988369 | 13043 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T234062 NZ_CP091622:1981028-1981131 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT234062 NZ_CP091622:c1981133-1980990 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG