Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2004037..2004180 | Replicon | chromosome |
| Accession | NZ_CP091611 | ||
| Organism | Salmonella enterica strain 1795 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2004075..2004178 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2004037..2004180 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| L5512_RS09585 | 2000461..2001159 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| L5512_RS09590 | 2001183..2001839 | - | 657 | WP_000100256.1 | nitrilase-related carbon-nitrogen hydrolase | - |
| L5512_RS09595 | 2001947..2002177 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| L5512_RS09600 | 2002315..2002689 | + | 375 | WP_000168396.1 | CopC domain-containing protein YobA | - |
| L5512_RS09605 | 2002690..2003565 | + | 876 | WP_000979699.1 | copper homeostasis membrane protein CopD | - |
| L5512_RS09610 | 2003582..2003935 | + | 354 | WP_126524015.1 | YebY family protein | - |
| - | 2004037..2004180 | - | 144 | - | - | Antitoxin |
| - | 2004075..2004178 | + | 104 | - | - | Toxin |
| L5512_RS09615 | 2004309..2004959 | - | 651 | Protein_1878 | tyrosine-type recombinase/integrase | - |
| L5512_RS09620 | 2004970..2005275 | + | 306 | WP_206519696.1 | hypothetical protein | - |
| L5512_RS09625 | 2005232..2005435 | + | 204 | Protein_1880 | phage tail protein | - |
| L5512_RS09630 | 2005607..2005762 | + | 156 | Protein_1881 | phage tail protein | - |
| L5512_RS09635 | 2005868..2006200 | + | 333 | WP_061383450.1 | DUF1353 domain-containing protein | - |
| L5512_RS09640 | 2006249..2006358 | + | 110 | Protein_1883 | tail fiber assembly protein | - |
| L5512_RS09645 | 2006449..2006634 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| L5512_RS09650 | 2006886..2007074 | - | 189 | Protein_1885 | tail fiber assembly protein | - |
| L5512_RS09655 | 2007070..2007840 | - | 771 | WP_000758583.1 | transporter substrate-binding domain-containing protein | - |
| L5512_RS09660 | 2007910..2008008 | + | 99 | Protein_1887 | DUF4113 domain-containing protein | - |
| L5512_RS09665 | 2008331..2008459 | + | 129 | Protein_1888 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1998373..2048193 | 49820 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T234000 NZ_CP091611:2004075-2004178 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT234000 NZ_CP091611:c2004180-2004037 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
