Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2631052..2631197 | Replicon | chromosome |
| Accession | NZ_CP091558 | ||
| Organism | Salmonella enterica strain 418 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2631054..2631157 (-) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2631052..2631197 (+) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| INN79_RS12950 | 2626180..2626380 | + | 201 | WP_010989029.1 | PagK family vesicle-borne virulence factor | - |
| INN79_RS12955 | 2626477..2626947 | - | 471 | Protein_2529 | tail fiber assembly protein | - |
| INN79_RS12960 | 2626957..2627301 | - | 345 | Protein_2530 | macro domain-containing protein | - |
| INN79_RS12965 | 2627516..2627776 | - | 261 | Protein_2531 | DUF1441 family protein | - |
| INN79_RS12970 | 2627831..2628019 | + | 189 | WP_001521334.1 | hypothetical protein | - |
| INN79_RS12975 | 2628084..2628251 | + | 168 | WP_000789530.1 | lytic enzyme | - |
| INN79_RS12980 | 2628508..2629041 | - | 534 | WP_001050882.1 | DUF2514 domain-containing protein | - |
| INN79_RS12985 | 2629095..2629286 | - | 192 | Protein_2535 | glycoside hydrolase family 19 protein | - |
| INN79_RS12990 | 2629275..2629736 | + | 462 | Protein_2536 | DNA breaking-rejoining protein | - |
| INN79_RS12995 | 2630000..2630923 | + | 924 | Protein_2537 | tyrosine-type recombinase/integrase | - |
| - | 2631052..2631197 | + | 146 | - | - | Antitoxin |
| - | 2631054..2631157 | - | 104 | - | - | Toxin |
| INN79_RS13000 | 2631297..2631650 | - | 354 | WP_000722368.1 | YebY family protein | - |
| INN79_RS13005 | 2631667..2632542 | - | 876 | WP_000979702.1 | copper homeostasis membrane protein CopD | - |
| INN79_RS13010 | 2632543..2632917 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| INN79_RS13015 | 2633055..2633285 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| INN79_RS13020 | 2633393..2634049 | + | 657 | WP_000100258.1 | carbon-nitrogen hydrolase family protein | - |
| INN79_RS13025 | 2634073..2634771 | + | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | - | 2616410..2636857 | 20447 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T233731 NZ_CP091558:c2631157-2631054 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT233731 NZ_CP091558:2631052-2631197 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
