Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 1527805..1527950 | Replicon | chromosome |
Accession | NZ_CP085815 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain Slowbro |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 1527807..1527910 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 1527805..1527950 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
LJF37_RS07665 | 1523005..1523223 | - | 219 | WP_001524708.1 | hypothetical protein | - |
LJF37_RS07670 | 1523525..1523623 | - | 99 | WP_223151200.1 | hypothetical protein | - |
LJF37_RS07675 | 1523942..1525921 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
LJF37_RS07680 | 1526335..1526613 | + | 279 | WP_001575998.1 | excisionase | - |
LJF37_RS07685 | 1526588..1527667 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 1527805..1527950 | + | 146 | - | - | Antitoxin |
- | 1527807..1527910 | - | 104 | - | - | Toxin |
LJF37_RS07690 | 1528050..1528403 | - | 354 | WP_000722370.1 | YebY family protein | - |
LJF37_RS07695 | 1528420..1529295 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
LJF37_RS07700 | 1529296..1529670 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
LJF37_RS07705 | 1529808..1530038 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
LJF37_RS07710 | 1530146..1530802 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
LJF37_RS07715 | 1530826..1531524 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 1473906..1535289 | 61383 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T221855 NZ_CP085815:c1527910-1527807 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT221855 NZ_CP085815:1527805-1527950 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG