Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2067951..2068096 | Replicon | chromosome |
Accession | NZ_CP079145 | ||
Organism | Klebsiella pneumoniae subsp. pneumoniae strain WRC06_CMC387MC |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2067987..2068089 (+) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2067951..2068096 (-) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KWY71_RS10055 | 2063081..2065141 | + | 2061 | WP_004151449.1 | oligopeptidase B | - |
KWY71_RS10060 | 2065145..2065804 | - | 660 | WP_043906809.1 | exodeoxyribonuclease X | - |
KWY71_RS10065 | 2065883..2066113 | - | 231 | WP_002911406.1 | DNA polymerase III subunit theta | - |
KWY71_RS10070 | 2066226..2066600 | + | 375 | WP_004151448.1 | CopC domain-containing protein YobA | - |
KWY71_RS10075 | 2066604..2067473 | + | 870 | WP_004151447.1 | copper homeostasis membrane protein CopD | - |
KWY71_RS10080 | 2067490..2067828 | + | 339 | WP_002911404.1 | YebY family protein | - |
- | 2067951..2068096 | - | 146 | - | - | Antitoxin |
- | 2067987..2068089 | + | 103 | - | - | Toxin |
KWY71_RS10085 | 2068465..2068608 | - | 144 | WP_002911398.1 | Ecr family regulatory small membrane protein | - |
KWY71_RS10090 | 2068713..2069681 | - | 969 | WP_004151446.1 | VirK/YbjX family protein | - |
KWY71_RS10095 | 2069838..2070491 | + | 654 | WP_004180432.1 | protein-serine/threonine phosphatase | - |
KWY71_RS10100 | 2070488..2070679 | - | 192 | WP_002911395.1 | YebW family protein | - |
KWY71_RS10105 | 2070777..2071016 | - | 240 | WP_002911393.1 | YebV family protein | - |
KWY71_RS10110 | 2071132..2072565 | - | 1434 | WP_004148845.1 | 16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | - | 1994896..2085492 | 90596 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 103 bp
>T209317 NZ_CP079145:2067987-2068089 [Klebsiella pneumoniae subsp. pneumoniae]
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
GCAAGGCGACTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATACA
GGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT209317 NZ_CP079145:c2068096-2067951 [Klebsiella pneumoniae subsp. pneumoniae]
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT
TAAAGATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAG
TTGGCATTAATGCAGGCTAAGTCGCCTTGCACTATAAGAATAGTTTAACGCGTCAGCTTTTCCAGT