Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2104624..2104767 | Replicon | chromosome |
| Accession | NZ_CP077699 | ||
| Organism | Salmonella enterica subsp. enterica strain CFSAN058591 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2104662..2104765 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2104624..2104767 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| DAY16_RS10055 | 2101049..2101747 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
| DAY16_RS10060 | 2101771..2102427 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| DAY16_RS10065 | 2102534..2102764 | - | 231 | WP_000856225.1 | DNA polymerase III subunit theta | - |
| DAY16_RS10070 | 2102902..2103276 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| DAY16_RS10075 | 2103277..2104152 | + | 876 | WP_000979696.1 | copper homeostasis membrane protein CopD | - |
| DAY16_RS10080 | 2104169..2104522 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2104624..2104767 | - | 144 | - | - | Antitoxin |
| - | 2104662..2104765 | + | 104 | - | - | Toxin |
| DAY16_RS10085 | 2104905..2105984 | - | 1080 | Protein_1980 | phage integrase Arm DNA-binding domain-containing protein | - |
| DAY16_RS10090 | 2106017..2107165 | - | 1149 | Protein_1981 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| DAY16_RS10095 | 2107157..2107405 | + | 249 | Protein_1982 | glycoside hydrolase family 19 protein | - |
| DAY16_RS10100 | 2107402..2107935 | + | 534 | WP_001529209.1 | DUF2514 domain-containing protein | - |
| DAY16_RS10105 | 2108204..2108371 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| DAY16_RS10110 | 2108674..2109165 | + | 492 | WP_001629197.1 | DUF1441 family protein | - |
| DAY16_RS10115 | 2109257..2109719 | + | 463 | Protein_1986 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2082753..2137772 | 55019 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T207548 NZ_CP077699:2104662-2104765 [Salmonella enterica subsp. enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT207548 NZ_CP077699:c2104767-2104624 [Salmonella enterica subsp. enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
