Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2741376..2741519 | Replicon | chromosome |
Accession | NZ_CP077662 | ||
Organism | Salmonella enterica strain S146 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2741378..2741481 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2741376..2741519 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
KTP10_RS13235 | 2736823..2737092 | + | 270 | WP_077248370.1 | hypothetical protein | - |
KTP10_RS13240 | 2737258..2737398 | + | 141 | WP_048348799.1 | hypothetical protein | - |
KTP10_RS13245 | 2737544..2738134 | - | 591 | Protein_2591 | transposase | - |
KTP10_RS23530 | 2738091..2738183 | - | 93 | WP_230855586.1 | hypothetical protein | - |
KTP10_RS13250 | 2738213..2740633 | - | 2421 | WP_048348800.1 | type III secretion system effector SspH3 | - |
KTP10_RS13255 | 2740806..2740889 | - | 84 | Protein_2594 | phage tail protein | - |
KTP10_RS13260 | 2740978..2741247 | + | 270 | WP_017441955.1 | tyrosine-type recombinase/integrase | - |
- | 2741376..2741519 | + | 144 | - | - | Antitoxin |
- | 2741378..2741481 | - | 104 | - | - | Toxin |
KTP10_RS13265 | 2741621..2741974 | - | 354 | WP_129339458.1 | YebY family protein | - |
KTP10_RS13270 | 2741991..2742866 | - | 876 | WP_072103686.1 | copper homeostasis membrane protein CopD | - |
KTP10_RS13275 | 2742867..2743241 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
KTP10_RS13280 | 2743379..2743609 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
KTP10_RS13285 | 2743717..2744373 | + | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
KTP10_RS13290 | 2744397..2745095 | + | 699 | WP_000944278.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T207358 NZ_CP077662:c2741481-2741378 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT207358 NZ_CP077662:2741376-2741519 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG