Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1082071..1082214 | Replicon | chromosome |
| Accession | NZ_CP075132 | ||
| Organism | Salmonella enterica subsp. enterica serovar Inverness strain CFSAN044911 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1082109..1082212 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1082071..1082214 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| A7S33_RS05390 | 1078495..1079193 | - | 699 | WP_000944279.1 | exodeoxyribonuclease X | - |
| A7S33_RS05395 | 1079217..1079873 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| A7S33_RS05400 | 1079981..1080211 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| A7S33_RS05405 | 1080349..1080723 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| A7S33_RS05410 | 1080724..1081599 | + | 876 | WP_001623761.1 | copper homeostasis membrane protein CopD | - |
| A7S33_RS05415 | 1081616..1081969 | + | 354 | WP_023227990.1 | YebY family protein | - |
| - | 1082071..1082214 | - | 144 | - | - | Antitoxin |
| - | 1082109..1082212 | + | 104 | - | - | Toxin |
| A7S33_RS05420 | 1082342..1083421 | - | 1080 | WP_001623770.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| A7S33_RS05425 | 1083454..1084605 | - | 1152 | Protein_1071 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| A7S33_RS05430 | 1084594..1084785 | + | 192 | Protein_1072 | glycoside hydrolase family 19 protein | - |
| A7S33_RS05435 | 1084839..1085372 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| A7S33_RS05440 | 1085629..1085796 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| A7S33_RS05445 | 1085861..1086049 | - | 189 | WP_001532317.1 | hypothetical protein | - |
| A7S33_RS05450 | 1086104..1086595 | + | 492 | WP_001623776.1 | DUF1441 family protein | - |
| A7S33_RS05455 | 1086582..1087149 | + | 568 | Protein_1077 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1076409..1106786 | 30377 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T203156 NZ_CP075132:1082109-1082212 [Salmonella enterica subsp. enterica serovar Inverness]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT203156 NZ_CP075132:c1082214-1082071 [Salmonella enterica subsp. enterica serovar Inverness]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
