Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 2057440..2057583 | Replicon | chromosome |
| Accession | NZ_CP075129 | ||
| Organism | Salmonella enterica subsp. enterica serovar Rubislaw strain CFSAN044921 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 2057478..2057581 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 2057440..2057583 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| A7S43_RS09740 | 2053865..2054563 | - | 699 | WP_000944280.1 | exodeoxyribonuclease X | - |
| A7S43_RS09745 | 2054587..2055243 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| A7S43_RS09750 | 2055350..2055580 | - | 231 | WP_000856225.1 | DNA polymerase III subunit theta | - |
| A7S43_RS09755 | 2055718..2056092 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| A7S43_RS09760 | 2056093..2056968 | + | 876 | WP_000979696.1 | copper homeostasis membrane protein CopD | - |
| A7S43_RS09765 | 2056985..2057338 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 2057440..2057583 | - | 144 | - | - | Antitoxin |
| - | 2057478..2057581 | + | 104 | - | - | Toxin |
| A7S43_RS09770 | 2057721..2058800 | - | 1080 | Protein_1918 | phage integrase Arm DNA-binding domain-containing protein | - |
| A7S43_RS09775 | 2058833..2059981 | - | 1149 | Protein_1919 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| A7S43_RS09780 | 2059973..2060221 | + | 249 | Protein_1920 | glycoside hydrolase family 19 protein | - |
| A7S43_RS09785 | 2060218..2060751 | + | 534 | WP_001529209.1 | DUF2514 domain-containing protein | - |
| A7S43_RS09790 | 2061020..2061187 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| A7S43_RS09795 | 2061490..2061981 | + | 492 | WP_070809055.1 | DUF1441 family protein | - |
| A7S43_RS09800 | 2062073..2062535 | + | 463 | Protein_1924 | phage terminase large subunit family protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 2035569..2090588 | 55019 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T203137 NZ_CP075129:2057478-2057581 [Salmonella enterica subsp. enterica serovar Rubislaw]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT203137 NZ_CP075129:c2057583-2057440 [Salmonella enterica subsp. enterica serovar Rubislaw]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
