Detailed information of TA system
Bioinformatically predictedOverview
TA module
Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
Location | 2686758..2686903 | Replicon | chromosome |
Accession | NZ_CP075120 | ||
Organism | Salmonella enterica subsp. enterica serovar Enteritidis strain CFSAN051882 |
Toxin (RNA)
Gene name | SdsR | ||
Locus tag | - | ||
Coordinates | 2686760..2686863 (-) |
Antitoxin (RNA)
Gene name | RyeA | ||
Locus tag | - | ||
Coordinates | 2686758..2686903 (+) |
Genomic Context
Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
---|---|---|---|---|---|---|
BCB01_RS13090 | 2681958..2682176 | - | 219 | WP_001524708.1 | hypothetical protein | - |
BCB01_RS23170 | 2682478..2682576 | - | 99 | WP_223151200.1 | hypothetical protein | - |
BCB01_RS13100 | 2682895..2684874 | - | 1980 | WP_001237395.1 | alkyl sulfatase dimerization domain-containing protein | - |
BCB01_RS13105 | 2685288..2685566 | + | 279 | WP_001575998.1 | excisionase | - |
BCB01_RS13110 | 2685541..2686620 | + | 1080 | WP_000087636.1 | phage integrase Arm DNA-binding domain-containing protein | - |
- | 2686758..2686903 | + | 146 | - | - | Antitoxin |
- | 2686760..2686863 | - | 104 | - | - | Toxin |
BCB01_RS13115 | 2687003..2687356 | - | 354 | WP_000722370.1 | YebY family protein | - |
BCB01_RS13120 | 2687373..2688248 | - | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
BCB01_RS13125 | 2688249..2688623 | - | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
BCB01_RS13130 | 2688761..2688991 | + | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
BCB01_RS13135 | 2689099..2689755 | + | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
BCB01_RS13140 | 2689779..2690477 | + | 699 | WP_000944288.1 | exodeoxyribonuclease X | - |
Associated MGEs
MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
---|---|---|---|---|---|---|---|
- | inside | Prophage | - | sopE2 / sopE2 / sodCI | 2632859..2708773 | 75914 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T203031 NZ_CP075120:c2686863-2686760 [Salmonella enterica subsp. enterica serovar Enteritidis]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT203031 NZ_CP075120:2686758-2686903 [Salmonella enterica subsp. enterica serovar Enteritidis]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG