Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1995074..1995217 | Replicon | chromosome |
| Accession | NZ_CP075109 | ||
| Organism | Salmonella enterica strain CFSAN060807 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1995112..1995215 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1995074..1995217 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| CIC24_RS09535 | 1991498..1992196 | - | 699 | WP_000944279.1 | exodeoxyribonuclease X | - |
| CIC24_RS09540 | 1992220..1992876 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| CIC24_RS09545 | 1992984..1993214 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| CIC24_RS09550 | 1993352..1993726 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| CIC24_RS09555 | 1993727..1994602 | + | 876 | WP_000979694.1 | copper homeostasis membrane protein CopD | - |
| CIC24_RS09560 | 1994619..1994972 | + | 354 | WP_000722370.1 | YebY family protein | - |
| - | 1995074..1995217 | - | 144 | - | - | Antitoxin |
| - | 1995112..1995215 | + | 104 | - | - | Toxin |
| CIC24_RS09565 | 1995345..1996186 | - | 842 | Protein_1872 | tyrosine-type recombinase/integrase | - |
| CIC24_RS09570 | 1996277..1996633 | + | 357 | WP_000003145.1 | hypothetical protein | - |
| CIC24_RS22990 | 1996587..1996793 | + | 207 | Protein_1874 | phage tail protein | - |
| CIC24_RS22995 | 1996965..1997120 | + | 156 | Protein_1875 | DUF4376 domain-containing protein | - |
| CIC24_RS23000 | 1997226..1997558 | + | 333 | WP_031609875.1 | DUF1353 domain-containing protein | - |
| CIC24_RS09580 | 1997607..1997716 | + | 110 | Protein_1877 | tail fiber assembly protein | - |
| CIC24_RS09585 | 1997807..1997992 | - | 186 | WP_012218702.1 | PagK family vesicle-borne virulence factor | - |
| CIC24_RS09590 | 1998235..1998432 | - | 198 | Protein_1879 | tail fiber assembly protein | - |
| CIC24_RS09595 | 1998428..1999198 | - | 771 | WP_001652627.1 | transporter substrate-binding domain-containing protein | - |
| CIC24_RS23005 | 1999274..1999366 | + | 93 | Protein_1881 | DUF4113 domain-containing protein | - |
| CIC24_RS09600 | 1999689..1999817 | + | 129 | Protein_1882 | helix-turn-helix domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1973204..2034564 | 61360 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T202867 NZ_CP075109:1995112-1995215 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT202867 NZ_CP075109:c1995217-1995074 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
