Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1944617..1944762 | Replicon | chromosome |
| Accession | NZ_CP075108 | ||
| Organism | Salmonella enterica strain CFSAN060808 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1944657..1944760 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1944617..1944762 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| CIC23_RS09250 | 1941043..1941741 | - | 699 | WP_000944285.1 | exodeoxyribonuclease X | - |
| CIC23_RS09255 | 1941765..1942421 | - | 657 | WP_000100257.1 | carbon-nitrogen hydrolase family protein | - |
| CIC23_RS09260 | 1942529..1942759 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| CIC23_RS09265 | 1942897..1943271 | + | 375 | WP_000168393.1 | CopC domain-containing protein YobA | - |
| CIC23_RS09270 | 1943272..1944147 | + | 876 | WP_072103328.1 | copper homeostasis membrane protein CopD | - |
| CIC23_RS09275 | 1944164..1944517 | + | 354 | WP_023261262.1 | YebY family protein | - |
| - | 1944617..1944762 | - | 146 | - | - | Antitoxin |
| - | 1944657..1944760 | + | 104 | - | - | Toxin |
| CIC23_RS09280 | 1944890..1945969 | - | 1080 | WP_000087646.1 | phage integrase Arm DNA-binding domain-containing protein | - |
| CIC23_RS09285 | 1946002..1947153 | - | 1152 | Protein_1822 | PD-(D/E)XK nuclease-like domain-containing protein | - |
| CIC23_RS09290 | 1947142..1947333 | + | 192 | Protein_1823 | glycoside hydrolase family 19 protein | - |
| CIC23_RS09295 | 1947387..1947920 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| CIC23_RS09300 | 1948177..1948344 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| CIC23_RS09305 | 1948409..1948597 | - | 189 | WP_001532317.1 | hypothetical protein | - |
| CIC23_RS09310 | 1948652..1948912 | + | 261 | Protein_1827 | DUF1441 family protein | - |
| CIC23_RS22480 | 1948914..1949129 | + | 216 | Protein_1828 | shikimate transporter | - |
| CIC23_RS09315 | 1949139..1949426 | + | 288 | Protein_1829 | macro domain-containing protein | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1922748..1977850 | 55102 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T202846 NZ_CP075108:1944657-1944760 [Salmonella enterica]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 146 bp
>AT202846 NZ_CP075108:c1944762-1944617 [Salmonella enterica]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTGCG
