Detailed information of TA system
Overview
TA module
| Type | VIII | Classification (family/domain) | SdsR-RyeA/- |
| Location | 1990943..1991086 | Replicon | chromosome |
| Accession | NZ_CP073715 | ||
| Organism | Salmonella enterica subsp. enterica serovar Bovismorbificans strain 2020LSAL11867 | ||
Toxin (RNA)
| Gene name | SdsR | ||
| Locus tag | - | ||
| Coordinates | 1990981..1991084 (+) |
Antitoxin (RNA)
| Gene name | RyeA | ||
| Locus tag | - | ||
| Coordinates | 1990943..1991086 (-) |
Genomic Context
| Locus tag | Coordinates | Strand | Size (bp) | Protein ID | Product | Description |
|---|---|---|---|---|---|---|
| KCG42_RS09510 | 1987367..1988065 | - | 699 | WP_000944282.1 | exodeoxyribonuclease X | - |
| KCG42_RS09515 | 1988089..1988745 | - | 657 | WP_000100249.1 | carbon-nitrogen hydrolase family protein | - |
| KCG42_RS09520 | 1988853..1989083 | - | 231 | WP_000856224.1 | DNA polymerase III subunit theta | - |
| KCG42_RS09525 | 1989221..1989595 | + | 375 | WP_000168395.1 | CopC domain-containing protein YobA | - |
| KCG42_RS09530 | 1989596..1990471 | + | 876 | WP_000979686.1 | copper homeostasis membrane protein CopD | - |
| KCG42_RS09535 | 1990488..1990841 | + | 354 | WP_000722368.1 | YebY family protein | - |
| - | 1990943..1991086 | - | 144 | - | - | Antitoxin |
| - | 1990981..1991084 | + | 104 | - | - | Toxin |
| KCG42_RS09540 | 1991213..1992136 | - | 924 | Protein_1871 | tyrosine-type recombinase/integrase | - |
| KCG42_RS09545 | 1992136..1992862 | - | 727 | Protein_1872 | exonuclease VIII | - |
| KCG42_RS09550 | 1992851..1993042 | + | 192 | Protein_1873 | glycoside hydrolase family 19 protein | - |
| KCG42_RS09555 | 1993096..1993629 | + | 534 | WP_001050883.1 | DUF2514 domain-containing protein | - |
| KCG42_RS09560 | 1993886..1994053 | - | 168 | WP_000789530.1 | lytic enzyme | - |
| KCG42_RS09565 | 1994118..1994309 | - | 192 | WP_001034750.1 | hypothetical protein | - |
| KCG42_RS09570 | 1994364..1994624 | + | 261 | Protein_1877 | DUF1441 family protein | - |
| KCG42_RS22590 | 1994626..1994841 | + | 216 | Protein_1878 | shikimate transporter | - |
| KCG42_RS09575 | 1994851..1995138 | + | 288 | Protein_1879 | macro domain-containing protein | - |
| KCG42_RS09580 | 1995151..1995662 | + | 512 | Protein_1880 | tail fiber assembly protein | - |
| KCG42_RS09585 | 1995759..1995959 | - | 201 | WP_001751604.1 | PagK family vesicle-borne virulence factor | - |
Associated MGEs
| MGE detail |
Similar MGEs |
Relative position |
MGE Type | Cargo ARG | Virulence gene | Coordinates | Length (bp) |
|---|---|---|---|---|---|---|---|
| - | inside | Prophage | - | sopE2 | 1985279..2030164 | 44885 |
Relative position:
(1) inside: TA loci is completely located inside the MGE;
(2) overlap: TA loci is partially overlapped with the MGE;
(3) flank: The TA loci is located in the 5 kb flanking regions of MGE.
Sequences
Toxin
Download Length: 104 bp
>T200055 NZ_CP073715:1990981-1991084 [Salmonella enterica subsp. enterica serovar Bovismorbificans]
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
GGCAAGGCGATTTAGCCTGCATTAATGCCAACTTTTAGCGCACGGCTCTCTCCCAAGAGCCATTTCCCTGGACCGAATAC
AGGAATCGTATTCGGTCTCTTTTT
Antitoxin
Download Length: 144 bp
>AT200055 NZ_CP073715:c1991086-1990943 [Salmonella enterica subsp. enterica serovar Bovismorbificans]
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
ATAAAAAGAGACCGAATACGATTCCTGTATTCGGTCCAGGGAAATGGCTCTTGGGAGAGAGCCGTGCGCTAAAAGTTGGC
ATTAATGCAGGCTAAATCGCCTTGCCCTTTAAGAATAGATGACGACGCCAGGTTTTCCAGTTTG
