Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   NYE20_RS02150 Genome accession   NZ_CP150252
Coordinates   423507..423629 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus sp. FSL R5-0416     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 418507..428629
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  NYE20_RS02135 (NYE20_02135) yclJ 420121..420804 (+) 684 WP_015482792.1 two-component system response regulator YclJ -
  NYE20_RS02140 (NYE20_02140) yclK 420791..422212 (+) 1422 WP_072173981.1 two-component system sensor histidine kinase YclK -
  NYE20_RS02145 (NYE20_02145) rapC 422375..423523 (+) 1149 WP_014475800.1 response regulator aspartate phosphatase RapC Regulator
  NYE20_RS02150 (NYE20_02150) phrC 423507..423629 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  NYE20_RS02155 (NYE20_02155) - 423729..423818 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  NYE20_RS02160 (NYE20_02160) - 423900..424013 (-) 114 WP_014478831.1 YjcZ family sporulation protein -
  NYE20_RS02165 (NYE20_02165) - 424166..425530 (-) 1365 WP_021481755.1 aspartate kinase -
  NYE20_RS02170 (NYE20_02170) ceuB 425915..426865 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  NYE20_RS02175 (NYE20_02175) yclO 426858..427805 (+) 948 WP_125121454.1 petrobactin ABC transporter permease YclO -
  NYE20_RS02180 (NYE20_02180) yclP 427799..428557 (+) 759 WP_161621347.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=967850 NYE20_RS02150 WP_003224994.1 423507..423629(+) (phrC) [Bacillus sp. FSL R5-0416]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=967850 NYE20_RS02150 WP_003224994.1 423507..423629(+) (phrC) [Bacillus sp. FSL R5-0416]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment