Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   ACHGMI_RS02645 Genome accession   NZ_CP172417
Coordinates   511804..511926 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain AKPS2     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 506804..516926
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  ACHGMI_RS02615 yclP 506875..507633 (-) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -
  ACHGMI_RS02620 yclO 507627..508574 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  ACHGMI_RS02625 ceuB 508567..509517 (-) 951 WP_017696153.1 petrobactin ABC transporter permease YclN Machinery gene
  ACHGMI_RS02630 thrD 509902..511266 (+) 1365 WP_017696152.1 aspartate kinase -
  ACHGMI_RS02635 yczN 511420..511533 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  ACHGMI_RS02640 yczM 511615..511704 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  ACHGMI_RS02645 phrC 511804..511926 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  ACHGMI_RS02650 rapC 511910..513058 (-) 1149 WP_017696151.1 response regulator aspartate phosphatase RapC Regulator
  ACHGMI_RS02655 yclK 513222..514643 (-) 1422 WP_080031080.1 two-component system sensor histidine kinase YclK -
  ACHGMI_RS02660 yclJ 514630..515313 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=953636 ACHGMI_RS02645 WP_003224994.1 511804..511926(-) (phrC) [Bacillus subtilis strain AKPS2]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=953636 ACHGMI_RS02645 WP_003224994.1 511804..511926(-) (phrC) [Bacillus subtilis strain AKPS2]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1