Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   AB3470_RS02165 Genome accession   NZ_CP162517
Coordinates   428066..428188 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BF12B1     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 423066..433188
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AB3470_RS02150 (AB3470_02150) yclJ 424680..425363 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  AB3470_RS02155 (AB3470_02155) yclK 425350..426771 (+) 1422 WP_113713032.1 two-component system sensor histidine kinase YclK -
  AB3470_RS02160 (AB3470_02160) rapC 426934..428082 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  AB3470_RS02165 (AB3470_02165) phrC 428066..428188 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  AB3470_RS02170 (AB3470_02170) yczM 428288..428377 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  AB3470_RS02175 (AB3470_02175) yczN 428459..428572 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  AB3470_RS02180 (AB3470_02180) thrD 428726..430090 (-) 1365 WP_396283657.1 aspartate kinase -
  AB3470_RS02185 (AB3470_02185) ceuB 430475..431425 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  AB3470_RS02190 (AB3470_02190) yclO 431418..432365 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  AB3470_RS02195 (AB3470_02195) yclP 432359..433117 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=923800 AB3470_RS02165 WP_003224994.1 428066..428188(+) (phrC) [Bacillus subtilis strain BF12B1]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=923800 AB3470_RS02165 WP_003224994.1 428066..428188(+) (phrC) [Bacillus subtilis strain BF12B1]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1