Detailed information    

insolico Bioinformatically predicted

Overview

Name   comC/blpC   Type   Regulator
Locus tag   AB1F71_RS08860 Genome accession   NZ_CP160386
Coordinates   1794088..1794228 (+) Length   46 a.a.
NCBI ID   WP_002267610.1    Uniprot ID   Q99QI5
Organism   Streptococcus mutans strain UA159 ykuR deletion     
Function   binding to ComD; induce autophosphorylation of ComD; regulation of comX expression (predicted from homology)   
Competence regulation

Genomic Context

Location: 1789088..1799228
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  AB1F71_RS08825 (AB1F71_08825) - 1789152..1789364 (-) 213 WP_002263744.1 Blp family class II bacteriocin -
  AB1F71_RS08830 (AB1F71_08830) - 1789769..1789933 (-) 165 WP_002265308.1 hypothetical protein -
  AB1F71_RS08835 (AB1F71_08835) - 1790373..1790585 (+) 213 Protein_1693 IS3 family transposase -
  AB1F71_RS08840 (AB1F71_08840) - 1790708..1791112 (-) 405 WP_002263912.1 hypothetical protein -
  AB1F71_RS08845 (AB1F71_08845) - 1791259..1791678 (-) 420 WP_002263913.1 hypothetical protein -
  AB1F71_RS08850 (AB1F71_08850) - 1793059..1793460 (-) 402 WP_002310604.1 hypothetical protein -
  AB1F71_RS08855 (AB1F71_08855) cipB 1793591..1793821 (-) 231 WP_002265368.1 Blp family class II bacteriocin Regulator
  AB1F71_RS08860 (AB1F71_08860) comC/blpC 1794088..1794228 (+) 141 WP_002267610.1 ComC/BlpC family leader-containing pheromone/bacteriocin Regulator
  AB1F71_RS08865 (AB1F71_08865) comD/blpH 1794370..1795695 (-) 1326 WP_002262113.1 GHKL domain-containing protein Regulator
  AB1F71_RS08870 (AB1F71_08870) comE/blpR 1795692..1796444 (-) 753 WP_002262114.1 response regulator transcription factor Regulator
  AB1F71_RS08875 (AB1F71_08875) - 1796916..1797554 (-) 639 WP_002262115.1 VTT domain-containing protein -
  AB1F71_RS08880 (AB1F71_08880) - 1797601..1798227 (-) 627 WP_002262116.1 hypothetical protein -

Sequence

Protein


Download         Length: 46 a.a.        Molecular weight: 5211.06 Da        Isoelectric Point: 10.4929

>NTDB_id=918063 AB1F71_RS08860 WP_002267610.1 1794088..1794228(+) (comC/blpC) [Streptococcus mutans strain UA159 ykuR deletion]
MKKTLSLKNDFKEIKTDELEIIIGGSGSLSTFFRLFNRSFTQALGK

Nucleotide


Download         Length: 141 bp        

>NTDB_id=918063 AB1F71_RS08860 WP_002267610.1 1794088..1794228(+) (comC/blpC) [Streptococcus mutans strain UA159 ykuR deletion]
ATGAAAAAAACACTATCATTAAAAAATGACTTTAAAGAAATTAAGACTGATGAATTAGAGATTATCATTGGCGGAAGCGG
AAGCCTATCAACATTTTTCCGGCTGTTTAACAGAAGTTTTACACAAGCTTTGGGAAAATAA

Domains

Predicted by InterProScan.

COMC family (ComC)

(1-32)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure
  PDB 2I2J

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comC/blpC Streptococcus mutans UA159

100

100

1