Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   QLQ05_RS21470 Genome accession   NZ_CP125762
Coordinates   4002501..4002623 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain KRS015     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 3997501..4007623
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  QLQ05_RS21440 yclP 3997572..3998330 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  QLQ05_RS21445 yclO 3998324..3999271 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  QLQ05_RS21450 ceuB 3999264..4000214 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  QLQ05_RS21455 thrD 4000599..4001963 (+) 1365 WP_003234493.1 aspartate kinase -
  QLQ05_RS21460 yczN 4002117..4002230 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  QLQ05_RS21465 yczM 4002312..4002401 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  QLQ05_RS21470 phrC 4002501..4002623 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  QLQ05_RS21475 rapC 4002607..4003755 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  QLQ05_RS21480 yclK 4003918..4005339 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  QLQ05_RS21485 yclJ 4005326..4006009 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=763957 QLQ05_RS21470 WP_003224994.1 4002501..4002623(-) (phrC) [Bacillus subtilis strain KRS015]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=763957 QLQ05_RS21470 WP_003224994.1 4002501..4002623(-) (phrC) [Bacillus subtilis strain KRS015]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1