Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   K6J99_RS02100 Genome accession   NZ_AP024623
Coordinates   418981..419103 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain BEST3102     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 413981..424103
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  K6J99_RS02085 (BsBEST3102_03650) yclJ 415595..416278 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  K6J99_RS02090 (BsBEST3102_03660) yclK 416265..417686 (+) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  K6J99_RS02095 (BsBEST3102_03670) rapC 417849..418997 (+) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  K6J99_RS02100 (BsBEST3102_03680) phrC 418981..419103 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  K6J99_RS02105 yczM 419203..419292 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  K6J99_RS02110 yczN 419374..419487 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  K6J99_RS02115 (BsBEST3102_03690) thrD 419641..421005 (-) 1365 WP_009966541.1 aspartate kinase -
  K6J99_RS02120 (BsBEST3102_03700) ceuB 421390..422340 (+) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  K6J99_RS02125 (BsBEST3102_03710) yclO 422333..423280 (+) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  K6J99_RS02130 (BsBEST3102_03720) yclP 423274..424032 (+) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=73813 K6J99_RS02100 WP_003224994.1 418981..419103(+) (phrC) [Bacillus subtilis strain BEST3102]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=73813 K6J99_RS02100 WP_003224994.1 418981..419103(+) (phrC) [Bacillus subtilis strain BEST3102]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1


Multiple sequence alignment