Detailed information    

insolico Bioinformatically predicted

Overview

Name   comGE   Type   Machinery gene
Locus tag   PWP91_RS12600 Genome accession   NZ_CP118738
Coordinates   2500037..2500333 (-) Length   98 a.a.
NCBI ID   WP_250354455.1    Uniprot ID   -
Organism   Lactococcus lactis strain P-1     
Function   dsDNA binding to the cell surface; assembly of the pseudopilus (predicted from homology)   
DNA binding and uptake

Genomic Context

Location: 2495037..2505333
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  PWP91_RS12565 (PWP91_12565) - 2495328..2496194 (+) 867 WP_260317978.1 RluA family pseudouridine synthase -
  PWP91_RS12570 (PWP91_12570) - 2496232..2497041 (-) 810 WP_014570791.1 metal ABC transporter permease -
  PWP91_RS12575 (PWP91_12575) - 2497034..2497771 (-) 738 WP_058211243.1 metal ABC transporter ATP-binding protein -
  PWP91_RS12580 (PWP91_12580) - 2497948..2498790 (-) 843 WP_015427160.1 metal ABC transporter substrate-binding protein -
  PWP91_RS12585 (PWP91_12585) - 2498787..2499224 (-) 438 WP_274998612.1 zinc-dependent MarR family transcriptional regulator -
  PWP91_RS12590 (PWP91_12590) comGG 2499305..2499589 (-) 285 WP_017865155.1 competence type IV pilus minor pilin ComGG Machinery gene
  PWP91_RS12595 (PWP91_12595) comGF 2499628..2500074 (-) 447 WP_032948129.1 competence type IV pilus minor pilin ComGF Machinery gene
  PWP91_RS12600 (PWP91_12600) comGE 2500037..2500333 (-) 297 WP_250354455.1 competence type IV pilus minor pilin ComGE Machinery gene
  PWP91_RS12605 (PWP91_12605) comGD 2500305..2500736 (-) 432 WP_012898621.1 competence type IV pilus minor pilin ComGD Machinery gene
  PWP91_RS12610 (PWP91_12610) comGC 2500696..2500965 (-) 270 WP_023349160.1 competence type IV pilus major pilin ComGC Machinery gene
  PWP91_RS12620 (PWP91_12620) - 2501462..2501662 (-) 201 WP_058203534.1 cold-shock protein -
  PWP91_RS12625 (PWP91_12625) - 2502719..2502862 (-) 144 WP_014573124.1 hypothetical protein -
  PWP91_RS12630 (PWP91_12630) - 2502938..2504410 (-) 1473 WP_274998613.1 ATP-binding protein -
  PWP91_RS12635 (PWP91_12635) - 2504550..2504828 (-) 279 WP_274998614.1 hypothetical protein -

Sequence

Protein


Download         Length: 98 a.a.        Molecular weight: 11049.88 Da        Isoelectric Point: 5.1148

>NTDB_id=723592 PWP91_RS12600 WP_250354455.1 2500037..2500333(-) (comGE) [Lactococcus lactis strain P-1]
MENLKRKSVKAYLLLESLISIALLAFLVSFIVSSLVQVRQKDTEEDQKIEALNVAQMAIESHLTELSINGSDIKIKENQN
LLIISNHGKEIMQLELQS

Nucleotide


Download         Length: 297 bp        

>NTDB_id=723592 PWP91_RS12600 WP_250354455.1 2500037..2500333(-) (comGE) [Lactococcus lactis strain P-1]
GTGGAAAATTTAAAAAGAAAATCAGTTAAGGCATATTTGCTTTTGGAAAGTTTAATTAGTATAGCTCTACTCGCTTTTCT
AGTCAGCTTTATCGTAAGTTCTCTTGTGCAAGTAAGACAAAAAGATACGGAAGAAGATCAAAAGATTGAAGCTTTAAACG
TGGCACAAATGGCGATTGAAAGTCACTTAACAGAATTATCAATCAACGGTTCTGATATAAAGATAAAAGAAAACCAAAAT
TTACTGATTATTAGTAATCATGGAAAGGAAATTATGCAACTTGAACTTCAAAGTTAA

Domains

Predicted by InterProScan.

Type II secretory pathway pseudopilin (ComGE)

(13-94)


Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comGE Lactococcus lactis subsp. cremoris KW2

65.979

98.98

0.653