Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   MKS87_RS02220 Genome accession   NZ_CP092631
Coordinates   431783..431905 (+) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain YB-15     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 426783..436905
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  MKS87_RS02205 (MKS87_02205) yclJ 428397..429080 (+) 684 WP_003246532.1 two-component system response regulator YclJ -
  MKS87_RS02210 (MKS87_02210) yclK 429067..430488 (+) 1422 WP_173613904.1 two-component system sensor histidine kinase YclK -
  MKS87_RS02215 (MKS87_02215) rapC 430651..431799 (+) 1149 WP_024571686.1 response regulator aspartate phosphatase RapC Regulator
  MKS87_RS02220 (MKS87_02220) phrC 431783..431905 (+) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  MKS87_RS02225 (MKS87_02225) yczM 432005..432094 (-) 90 WP_015482794.1 YjcZ family sporulation protein -
  MKS87_RS02230 (MKS87_02230) yczN 432176..432289 (-) 114 WP_003234495.1 YjcZ family sporulation protein -
  MKS87_RS02235 (MKS87_02235) thrD 432443..433807 (-) 1365 WP_153255669.1 aspartate kinase -
  MKS87_RS02240 (MKS87_02240) ceuB 434192..435142 (+) 951 WP_014475804.1 petrobactin ABC transporter permease YclN Machinery gene
  MKS87_RS02245 (MKS87_02245) yclO 435135..436082 (+) 948 WP_173613905.1 petrobactin ABC transporter permease YclO -
  MKS87_RS02250 (MKS87_02250) yclP 436076..436834 (+) 759 WP_014475806.1 petrobactin ABC transporter ATP-binding protein YclP -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=567299 MKS87_RS02220 WP_003224994.1 431783..431905(+) (phrC) [Bacillus subtilis strain YB-15]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=567299 MKS87_RS02220 WP_003224994.1 431783..431905(+) (phrC) [Bacillus subtilis strain YB-15]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1