Detailed information    

insolico Bioinformatically predicted

Overview

Name   comE/comE2   Type   Regulator
Locus tag   I6J15_RS09290 Genome accession   NZ_CP068056
Coordinates   810422..810508 (+) Length   28 a.a.
NCBI ID   WP_250543510.1    Uniprot ID   -
Organism   Streptococcus lutetiensis strain FDAARGOS_1158     
Function   activate transcription of early competence genes (predicted from homology)   
Competence regulation

Genomic Context

Location: 805422..815508
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  I6J15_RS04160 (I6J15_04160) rsmA 805423..806295 (+) 873 WP_021143191.1 16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA -
  I6J15_RS04165 (I6J15_04165) - 806702..806851 (+) 150 WP_020917491.1 hypothetical protein -
  I6J15_RS04170 (I6J15_04170) - 806864..807169 (+) 306 WP_020917490.1 bacteriocin immunity protein -
  I6J15_RS04175 (I6J15_04175) - 807197..807490 (+) 294 WP_020917489.1 bacteriocin immunity protein -
  I6J15_RS04180 (I6J15_04180) comD/comD2 808386..809219 (+) 834 WP_111713004.1 sensor histidine kinase Regulator
  I6J15_RS09065 comE/comE2 809777..810004 (+) 228 WP_233422877.1 hypothetical protein Regulator
  I6J15_RS09070 comE/comE2 809989..810369 (+) 381 WP_267895290.1 LytR/AlgR family response regulator transcription factor Regulator
  I6J15_RS09290 comE/comE2 810422..810508 (+) 87 WP_250543510.1 hypothetical protein Regulator
  I6J15_RS04195 (I6J15_04195) rsgA 810826..811698 (+) 873 WP_058832824.1 ribosome small subunit-dependent GTPase A -
  I6J15_RS04200 (I6J15_04200) rpe 811705..812367 (+) 663 WP_020917487.1 ribulose-phosphate 3-epimerase -
  I6J15_RS04205 (I6J15_04205) - 812360..812992 (+) 633 WP_020917486.1 thiamine diphosphokinase -
  I6J15_RS04210 (I6J15_04210) rmuC 812994..814268 (+) 1275 WP_020917485.1 DNA recombination protein RmuC -
  I6J15_RS04215 (I6J15_04215) - 814258..815196 (+) 939 WP_020917484.1 3'-5' exoribonuclease YhaM family protein -

Sequence

Protein


Download         Length: 28 a.a.        Molecular weight: 3460.04 Da        Isoelectric Point: 8.9747

>NTDB_id=458633 I6J15_RS09290 WP_250543510.1 810422..810508(+) (comE/comE2) [Streptococcus lutetiensis strain FDAARGOS_1158]
MVYFDDDKACYVSRKYIKDLRSKMENLK

Nucleotide


Download         Length: 87 bp        

>NTDB_id=458633 I6J15_RS09290 WP_250543510.1 810422..810508(+) (comE/comE2) [Streptococcus lutetiensis strain FDAARGOS_1158]
TTGGTTTATTTTGACGATGATAAAGCTTGTTATGTTTCTAGAAAATATATCAAAGACTTAAGGTCAAAAATGGAAAATCT
GAAATAG

Domains


No domain identified.



Secondary structure

Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure

Source ID Structure

Transmembrane helices

Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.


Visualization of predicted probability:


Similar proteins

Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  comE/comE2 Streptococcus equinus JB1

96.429

100

0.964