Detailed information    

insolico Bioinformatically predicted

Overview


Name   phrC   Type   Regulator
Locus tag   IRJ26_RS05560 Genome accession   NZ_CP064094
Coordinates   1040456..1040578 (-) Length   40 a.a.
NCBI ID   WP_003224994.1    Uniprot ID   G4NQY6
Organism   Bacillus subtilis strain N1108-5at     
Function   antagonize RapC (predicted from homology)   
Competence regulation

Genomic Context


Location: 1035456..1045578
Locus tag Gene name Coordinates (strand) Size (bp) Protein ID Product Description
  IRJ26_RS05530 yclP 1035527..1036285 (-) 759 WP_003234487.1 petrobactin ABC transporter ATP-binding protein YclP -
  IRJ26_RS05535 yclO 1036279..1037226 (-) 948 WP_003246705.1 petrobactin ABC transporter permease YclO -
  IRJ26_RS05540 ceuB 1037219..1038169 (-) 951 WP_003234491.1 petrobactin ABC transporter permease YclN Machinery gene
  IRJ26_RS05545 thrD 1038554..1039918 (+) 1365 WP_003234493.1 aspartate kinase -
  IRJ26_RS05550 yczN 1040072..1040185 (+) 114 WP_003234495.1 YjcZ family sporulation protein -
  IRJ26_RS05555 yczM 1040267..1040356 (+) 90 WP_015482794.1 YjcZ family sporulation protein -
  IRJ26_RS05560 phrC 1040456..1040578 (-) 123 WP_003224994.1 phosphatase RapC inhibitor PhrC Regulator
  IRJ26_RS05565 rapC 1040562..1041710 (-) 1149 WP_003246686.1 response regulator aspartate phosphatase RapC Regulator
  IRJ26_RS05570 yclK 1041873..1043294 (-) 1422 WP_009969263.1 two-component system sensor histidine kinase YclK -
  IRJ26_RS05575 yclJ 1043281..1043964 (-) 684 WP_003246532.1 two-component system response regulator YclJ -

Sequence


Protein


Download         Length: 40 a.a.        Molecular weight: 4197.98 Da        Isoelectric Point: 8.0285

>NTDB_id=441864 IRJ26_RS05560 WP_003224994.1 1040456..1040578(-) (phrC) [Bacillus subtilis strain N1108-5at]
MKLKSKLFVICLAAAAIFTAAGVSANAEALDFHVTERGMT

Nucleotide


Download         Length: 123 bp        

>NTDB_id=441864 IRJ26_RS05560 WP_003224994.1 1040456..1040578(-) (phrC) [Bacillus subtilis strain N1108-5at]
ATGAAATTGAAATCTAAGTTGTTTGTTATTTGTTTGGCCGCAGCCGCGATTTTTACAGCGGCTGGCGTTTCTGCTAATGC
GGAAGCACTCGACTTTCATGTGACAGAAAGAGGAATGACGTAA


Secondary structure


Protein secondary structures were predicted by S4PRED and visualized by seqviz.



3D structure


Source ID Structure
  AlphaFold DB G4NQY6

Transmembrane helices


Transmembrane helices of protein were predicted by TMHMM 2.0 and visualized by seqviz and ECharts.



Visualization of predicted probability:


Similar proteins


Only experimentally validated proteins are listed.

Protein Organism Identities (%) Coverage (%) Ha-value
  phrC Bacillus subtilis subsp. subtilis str. 168

100

100

1