I. Information of ICE

ICEberg ID	384
Name	ICEPaePA14-1
Organism	Pseudomonas aeruginosa UCBPP-PA14
Size (bp)	26735
GC content [Genome] (%)	61.02[66.29]
Insertion site	GMP synthase
Function	-
Species that ICE can be transferred to	-
Nucleotide Sequence	CP000438 (complete ICE sequence in this genome)
Replicon	chromosome (6537648 bp, BioProject:386) [NC_008463]
Genome coordinates	1300805..1327539
Putative oriT region	coordinates: 1312524..1312633;   oriTDB id:  100041 CGGGCAGGATGTGTGAAGTAGGCCCACCCGCAAGCGGGTTGTCCTTCTTCACGTCCCCTTATTCGCGCCG GGGGCGCTCAACGGGGCATCCTGCTCTGCGAGGCTGCCGG
Putative relaxase	-

II. ICE interaction with IME/CIME/

The interaction information of ICEPaePA14-1 is not available.

The graph information of ICEPaePA14-1 components from CP000438
Complete gene list of ICEPaePA14-1 from CP000438
#	Gene	Coordinates [+/-], size (bp)	Product  (GenBank annotation)	*Reannotation
1	PA14_15290	1296452..1297429 [-], 978	putative regulatory protein
2	guaB	1297693..1299162 [+], 1470	inosine-5-monophosphate dehydrogenase
3	guaA	1299242..1300819 [+], 1578	GMP synthase
4	PA14_15350	1301126..1302328 [+], 1203	putative integrase	Integrase
5	PA14_15360	1302743..1303723 [-], 981	hypothetical protein
6	PA14_15370	1303857..1304084 [-], 228	hypothetical protein
7	repA	1304052..1304930 [+], 879	replicative helicase, RepA
8	repC	1304902..1305789 [+], 888	putative replication protein, RepC
9	tnpR	1306410..1306970 [-], 561	putative resolvase, essential for transposition
10	PA14_15435	1307101..1308090 [-], 990	hypothetical protein
11	merE	1308087..1308323 [-], 237	mercuric resistance protein MerE
12	merD	1308320..1308685 [-], 366	Mercuric resistence transcriptional repressor protein MerD
13	merA	1308703..1310388 [-], 1686	Mercuric reductase MerA
14	merP	1310460..1310735 [-], 276	Periplasmic mercuric ion binding protein, MerP
15	merT	1310748..1311098 [-], 351	Mercuric transport protein MerT
16	merR	1311170..1311604 [+], 435	Regulatory protein merR
17	PA14_15490	1311858..1312034 [+], 177	hypothetical protein
18	traK	1312074..1312361 [+], 288	possible oriT-binding protein, TraK
19	traJ	1312655..1313026 [+], 372	oriT-binding protein, TraJ
20	trbJ	1313291..1314076 [+], 786	mating pair formation protein TrbJ	TrbJ, T4SS component
21	trbK	1314094..1314369 [+], 276	possible entry/exclusion protein TrbK	TrbK, T4SS component
22	trbL	1314366..1315988 [+], 1623	putative mating pair formation protein TrbL	TrbL, T4SS component
23	PA14_15560	1316504..1316812 [-], 309	hypothetical protein
24	PA14_15570	1317148..1317348 [+], 201	hypothetical protein
25	PA14_15580	1317407..1320187 [+], 2781	possible Type II restriction enzyme, methylase subunit
26	PA14_15590	1321218..1323335 [+], 2118	conserved hypothetical protein
27	PA14_15600	1323328..1324512 [+], 1185	conserved hypothetical protein
28	PA14_15610	1324805..1327411 [+], 2607	conserved hypothetical protein
29	PA14_15620	1328012..1328974 [+], 963	possible dehydrogenase
30	PA14_15630	1328895..1330193 [+], 1299	hypothetical protein
31	PA14_15650	1330245..1331201 [-], 957	conserved hypothetical protein
32	PA14_15660	1331350..1332345 [+], 996	probable oxidoreductase

Flanking regions